Identification
- Summary
Nitrous acid is an iron binder used to reverse life-threatening acute cyanide poisoning.
- Brand Names
- Nithiodote
- Generic Name
- Nitrous acid
- DrugBank Accession Number
- DB09112
- Background
Nitrous acid (as sodium nitrite) is used as part of an intravenous mixture with sodium thiosulfate to treat cyanide poisoning. It is on the World Health Organization's List of Essential Medicines, a list of the most important medications needed in a basic health system. There is also research to investigate its applicability towards treatments for heart attacks, brain aneurysms, pulmonary hypertension in infants, and Pseudomonas aeruginosa infections.
- Type
- Small Molecule
- Groups
- Approved, Investigational
- Structure
Structure for Nitrous acid (DB09112)
- Weight
- Average: 47.0134
Monoisotopic: 47.000728281 - Chemical Formula
- HNO2
- Synonyms
- dioxonitric acid
- hydroxidooxidonitrogen
- nitrosyl hydroxide
Pharmacology
- Indication
For sequential use with sodium thiosulfate for the treatment of acute cyanide poisoning that is judged to be life-threatening Label.
Reduce drug development failure ratesBuild, train, & validate machine-learning modelswith evidence-based and structured datasets.Build, train, & validate predictive machine-learning models with structured datasets.- Associated Conditions
Indication Type Indication Combined Product Details Approval Level Age Group Patient Characteristics Dose Form Used in combination to treat Cyanide poisoning Combination Product in combination with: Thiosulfuric acid (DB09499) •••••••••••• Used in combination to treat Toxic effect of hydrocyanic acid and cyanides Regimen in combination with: Thiosulfuric acid (DB09499) •••••••••••• •••••••••• •••••••• - Contraindications & Blackbox Warnings
Prevent Adverse Drug Events TodayTap into our Clinical API for life-saving information on contraindications & blackbox warnings, population restrictions, harmful risks, & more.Avoid life-threatening adverse drug events with our Clinical API- Pharmacodynamics
Sodium nitrite reverses cyanide toxicity and produces blood vessel dilation 1.
- Mechanism of action
Cyanide has a high affinity for the oxidized form of iron (Fe3+) such as that found in cytochrome oxidase a3 2. Cyanide binds to and inhibits cytochrome oxidase a3, preventing oxidative phophorylation from occuring. The resultant lack of ATP cannot support normal cellular processes, particularly in the brain. Compensatory increases in anaerobic respiration result in rising levels of lactic acid and subsequent acidosis.
Nitrite primarily acts by oxidizing hemoglobin to methemoglobin 1. The now oxidized Fe3+ in methemoglobin also binds cyanide with high affinity and accepts cyanide from cytochrome a3. This leaves cytochrome a3 free to resume its function in oxidative phosphorylation. The slow dissociation of cyanide from methemoglobin allows hepatic enzymes such as rhodanese to detoxify the compound without further systemic toxicity occuring. Methemoglobin is reduced back to hemoglobin by methemoglobin reductase allowing the affected blood cells to resume normal functioning.
The reduction of nitrite by hemoglobin results in the formation of nitric oxide 3. Nitric oxide acts as a powerful vasodilator, producing vascular smooth muscle relaxation through activation of soluble guanylate cyclase and the subsequent cyclic guanylyl triphosphate mediated signalling cascade 4.
Target Actions Organism AHemoglobin subunit alpha oxidizerHumans AHemoglobin subunit beta oxidizerHumans UMyoglobin oxidizerHumans - Absorption
Not Available
- Volume of distribution
Not Available
- Protein binding
Not Available
- Metabolism
Reduced by deoxyhemoglobin to form nitric oxide 3. Nitrite is also reduced to nitric oxide and further reduced to ammonia by gut bacteria 6. Nitrite can be oxidized to nitrate by oxyhemoglobin.
Hover over products below to view reaction partners
- Route of elimination
Not Available
- Half-life
Half life of 0.4-0.78h 5.
- Clearance
Not Available
- Adverse Effects
Improve decision support & research outcomesWith structured adverse effects data, including: blackbox warnings, adverse reactions, warning & precautions, & incidence rates. View sample adverse effects data in our new Data Library!Improve decision support & research outcomes with our structured adverse effects data.- Toxicity
Oral LD50 of 157.9mg/kg observed in rats and 175mg/kg observed in mice MSDS. Estimated oral LD50 of 35mg/kg in humans 1. Sodium nitrite toxicity manifests as cardiovascular collapse following severe hypotension due to nitrite's vasodilatory action.
- Pathways
- Not Available
- Pharmacogenomic Effects/ADRs Browse all" title="About SNP Mediated Effects/ADRs" id="snp-actions-info" class="drug-info-popup" href="javascript:void(0);">
Interacting Gene/Enzyme Allele name Genotype(s) Defining Change(s) Type(s) Description Details Glucose-6-phosphate 1-dehydrogenase Villeurbanne Not Available 1000_1002delACC ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Torun Not Available 1006A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Sunderland Not Available 105_107delCAT ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Iwatsuki Not Available 1081G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Serres Not Available 1082C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Tondela Not Available 1084_1101delCTGAACGAGCGCAAGGCC ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Loma Linda Not Available 1089C->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Aachen Not Available 1089C->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Tenri Not Available 1096A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Montpellier Not Available 1132G>A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Calvo Mackenna Not Available 1138A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Riley Not Available 1139T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Olomouc Not Available 1141T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Tomah Not Available 1153T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Lynwood Not Available 1154G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Madrid Not Available 1155C->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Iowa, Walter Reed, Springfield Not Available 1156A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Beverly Hills, Genova, Iwate, Niigata, Yamaguchi Not Available 1160G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Hartford Not Available 1162A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Praha Not Available 1166A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Krakow Not Available 1175T>C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Wisconsin Not Available 1177C->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Nashville, Anaheim, Portici Not Available 1178G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Alhambra Not Available 1180G->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Bari Not Available 1187C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Puerto Limon Not Available 1192G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Covao do Lobo Not Available 1205C>A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Clinic Not Available 1215G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Utrecht Not Available 1225C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Suwalki Not Available 1226C->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Riverside Not Available 1228G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Japan, Shinagawa Not Available 1229G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Kawasaki Not Available 1229G->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Munich Not Available 1231A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Georgia Not Available 1284C->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Sumare Not Available 1292T->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Telti/Kobe Not Available 1318C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Santiago de Cuba, Morioka Not Available 1339G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Harima Not Available 1358T->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Figuera da Foz Not Available 1366G->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Amiens Not Available 1367A>T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Bangkok Noi Not Available 1376G->T, 1502T->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Fukaya Not Available 1462G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Campinas Not Available 1463G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Buenos Aires Not Available 1465C>T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Arakawa Not Available 1466C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Brighton Not Available 1488_1490delGAA ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Kozukata Not Available 159G->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Amsterdam Not Available 180_182delTCT ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase No name Not Available 202G->A, 376A->G, 1264C>G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Swansea Not Available 224T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Urayasu Not Available 281_283delAGA ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Vancouver Not Available 317C->G544C->T592C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Mt Sinai Not Available 376A->G, 1159C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Plymouth Not Available 488G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Volendam Not Available 514C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Shinshu Not Available 527A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Chikugo Not Available 535A->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Tsukui Not Available 561_563delCTC ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Pedoplis-Ckaro Not Available 573C>G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Santiago Not Available 593G->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Minnesota, Marion, Gastonia, LeJeune Not Available 637G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Cincinnati Not Available 637G->T, 1037A->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Harilaou Not Available 648T->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase North Dallas Not Available 683_685delACA ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Asahikawa Not Available 695G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Durham Not Available 713A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Stonybrook Not Available 724_729delGGCACT ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Wayne Not Available 769C->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Aveiro Not Available 806G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Cleveland Corum Not Available 820G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Lille Not Available 821A>T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Bangkok Not Available 825G>C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Sugao Not Available 826C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase La Jolla Not Available 832T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Wexham Not Available 833C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Piotrkow Not Available 851T>C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase West Virginia Not Available 910G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Omiya Not Available 921G->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Nara Not Available 953_976delCCACCAAAGGGTACCTGGAC GACC ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Manhattan Not Available 962G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Rehevot Not Available 964T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Honiara Not Available 99A->G / 1360C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Tokyo, Fukushima Not Available 1246G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Chatham Not Available 1003G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Fushan Not Available 1004C->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Partenope Not Available 1052G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Ierapetra Not Available 1057C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Anadia Not Available 1193A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Abeno Not Available 1220A->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Surabaya Not Available 1291G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Pawnee Not Available 1316G->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase S. Antioco Not Available 1342A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Cassano Not Available 1347G->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Hermoupolis Not Available 1347G->C / 1360C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Union,Maewo, Chinese-2, Kalo Not Available 1360C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Andalus Not Available 1361G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Cosenza Not Available 1376G->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Canton, Taiwan- Hakka, Gifu-like, Agrigento-like Not Available 1376G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Flores Not Available 1387C->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Kaiping, Anant, Dhon, Sapporo-like, Wosera Not Available 1388G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Kamogawa Not Available 169C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Costanzo Not Available 179T>C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Amazonia Not Available 185C->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Songklanagarind Not Available 196T->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Hechi Not Available 202G->A / 871G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Namouru Not Available 208T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Bao Loc Not Available 352T>C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Crispim Not Available 375G->T, 379G->T383T->C384C>T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Acrokorinthos Not Available 376A->G / 463C->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Santa Maria Not Available 376A->G / 542A->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Ananindeua Not Available 376A->G / 871G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Vanua Lava Not Available 383T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Valladolid Not Available 406C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Belem Not Available 409C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Liuzhou Not Available 442G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Shenzen Not Available 473G>A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Taipei ‚ÄúChinese- 3‚Äù Not Available 493A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Toledo Not Available 496C>T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Naone Not Available 497G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Nankang Not Available 517T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Miaoli Not Available 519C->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham Not Available 563C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Coimbra Shunde Not Available 592C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Nilgiri Not Available 593G>A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Radlowo Not Available 679C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Roubaix Not Available 811G>C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Haikou Not Available 835A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Chinese-1 Not Available 835A->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Mizushima Not Available 848A>G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Osaka Not Available 853C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Viangchan, Jammu Not Available 871G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Seoul Not Available 916G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Ludhiana Not Available 929G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Farroupilha Not Available 977C->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Chinese-5 Not Available 1024C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Rignano Not Available 130G>A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Orissa Not Available 131C->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase G6PDNice Not Available 1380G>C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Kamiube, Keelung Not Available 1387C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Neapolis Not Available 1400C->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Aures Not Available 143T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Split Not Available 1442C->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Kambos Not Available 148C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Palestrina Not Available 170G>A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Metaponto Not Available 172G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Musashino Not Available 185C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Asahi Not Available 202G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase A- (202), Ferrara I Not Available 202G->A / 376A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Murcia Oristano Not Available 209A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Ube Konan Not Available 241C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Lagosanto Not Available 242G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Guangzhou Not Available 274C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Hammersmith Not Available 323T->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Sinnai Not Available 34G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase A- (680) Not Available 376A->G / 680G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase A- (968), Betica,Selma, Guantanamo Not Available 376A->G / 968T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Salerno Pyrgos Not Available 383T>G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Quing Yan Not Available 392G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Lages Not Available 40G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Ilesha Not Available 466G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Mahidol Not Available 487G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Malaga Not Available 542A->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Sibari Not Available 634A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Mexico City Not Available 680G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Nanning Not Available 703C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Seattle, Lodi, Modena, Ferrara II, Athens-like Not Available 844G->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Bajo Maumere Not Available 844G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Montalbano Not Available 854G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Kalyan-Kerala, Jamnaga, Rohini Not Available 949G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Gaohe Not Available 95A->G ADR Inferred Increased risk of hemolytic crisis. Details
Interactions
- Drug Interactions Learn More" title="About Drug Interactions" id="structured-interactions-info" class="drug-info-popup" href="javascript:void(0);">
- This information should not be interpreted without the help of a healthcare provider. If you believe you are experiencing an interaction, contact a healthcare provider immediately. The absence of an interaction does not necessarily mean no interactions exist.
Drug Interaction Integrate drug-drug
interactions in your softwareAbaloparatide The risk or severity of adverse effects can be increased when Abaloparatide is combined with Nitrous acid. Acebutolol The risk or severity of adverse effects can be increased when Acebutolol is combined with Nitrous acid. Aldesleukin The risk or severity of adverse effects can be increased when Aldesleukin is combined with Nitrous acid. Aliskiren The risk or severity of adverse effects can be increased when Aliskiren is combined with Nitrous acid. Ambrisentan Nitrous acid may increase the hypotensive activities of Ambrisentan. - Food Interactions
- No interactions found.
Products
Drug product information from 10+ global regionsOur datasets provide approved product information including:dosage, form, labeller, route of administration, and marketing period.Access drug product information from over 10 global regions.- Product Ingredients
Ingredient UNII CAS InChI Key Potassium nitrite 794654G42L Not Available Not applicable Sodium nitrite M0KG633D4F 7632-00-0 LPXPTNMVRIOKMN-UHFFFAOYSA-M - Active Moieties
Name Kind UNII CAS InChI Key Nitrite ionic J39976L608 14797-65-0 IOVCWXUNBOPUCH-UHFFFAOYSA-M - Brand Name Prescription Products
Name Dosage Strength Route Labeller Marketing Start Marketing End Region Image Sodium Nitrite Injection, solution 30 mg/1mL Intravenous Hope Pharmaceuticals 2012-02-14 Not applicable US 
Sodium Nitrite Injection, USP Solution 30 mg / mL Intravenous Hope Pharmaceuticals 2016-07-20 Not applicable Canada 
- Mixture Products
Name Ingredients Dosage Route Labeller Marketing Start Marketing End Region Image CVS Pharmacy Enamel Guard Potassium nitrite (5 g/100g) + Sodium fluoride (0.15 g/100g) Paste, dentifrice Dental CVS PHARMACY 2012-10-01 Not applicable US Nithiodote Sodium nitrite (30 mg/1mL) + Sodium thiosulfate pentahydrate (250 mg/1mL) Injection, solution; Kit Intravenous Hope Pharmaceuticals 2011-01-14 Not applicable US Rite Aid Enamel Guard Potassium nitrite (5 g/100g) + Sodium fluoride (0.15 g/100g) Paste, dentifrice Dental Rite Aid 2013-06-03 Not applicable US Wakefern Enamel Guard Potassium nitrite (5 g/100g) + Sodium fluoride (0.15 g/100g) Paste, dentifrice Dental Wakefern 2014-02-03 2019-03-01 US
Categories
- ATC Codes
- V03AB08 — Sodium nitrite
- Drug Categories
- Acids
- Acids, Noncarboxylic
- Anions
- Antidotes
- Compounds used in a research, industrial, or household setting
- Diet, Food, and Nutrition
- Electrolytes
- Food
- Food Additives
- Food Ingredients
- Food Preservatives
- Hypotensive Agents
- Indicators and Reagents
- Ions
- Laboratory Chemicals
- Nitrites
- Nitrogen Compounds
- Physiological Phenomena
- Sodium Compounds
- Classification
- Not classified
- Affected organisms
- Not Available
Chemical Identifiers
- UNII
- T2I5UM75DN
- CAS number
- 7782-77-6
- InChI Key
- IOVCWXUNBOPUCH-UHFFFAOYSA-N
- InChI
- InChI=1S/HNO2/c2-1-3/h(H,2,3)
- IUPAC Name
- nitrous acid
- SMILES
- ON=O
References
- General References
- Baskin SI, Horowitz AM, Nealley EW: The antidotal action of sodium nitrite and sodium thiosulfate against cyanide poisoning. J Clin Pharmacol. 1992 Apr;32(4):368-75. [Article]
- Beasley DM, Glass WI: Cyanide poisoning: pathophysiology and treatment recommendations. Occup Med (Lond). 1998 Oct;48(7):427-31. [Article]
- Lundberg JO, Weitzberg E, Gladwin MT: The nitrate-nitrite-nitric oxide pathway in physiology and therapeutics. Nat Rev Drug Discov. 2008 Feb;7(2):156-67. doi: 10.1038/nrd2466. [Article]
- Denninger JW, Marletta MA: Guanylate cyclase and the .NO/cGMP signaling pathway. Biochim Biophys Acta. 1999 May 5;1411(2-3):334-50. [Article]
- Rix PJ, Vick A, Attkins NJ, Barker GE, Bott AW, Alcorn H Jr, Gladwin MT, Shiva S, Bradley S, Hussaini A, Hoye WL, Parsley EL, Masamune H: Pharmacokinetics, pharmacodynamics, safety, and tolerability of nebulized sodium nitrite (AIR001) following repeat-dose inhalation in healthy subjects. Clin Pharmacokinet. 2015 Mar;54(3):261-72. doi: 10.1007/s40262-014-0201-y. [Article]
- Tiso M, Schechter AN: Nitrate reduction to nitrite, nitric oxide and ammonia by gut bacteria under physiological conditions. PLoS One. 2015 Mar 24;10(3):e0119712. doi: 10.1371/journal.pone.0119712. eCollection 2015. [Article]
- External Links
- KEGG Compound
- C00088
- PubChem Compound
- 23668193
- PubChem Substance
- 310265030
- ChemSpider
- 22936
- BindingDB
- 50147619
- ChEBI
- 25567
- ChEMBL
- CHEMBL1161681
- PharmGKB
- PA166115361
- PDBe Ligand
- 2NO
- Wikipedia
- Nitrous_acid
- PDB Entries
- 1aom / 1aoq / 4fqf / 5i6o
- FDA label
- Download (250 KB)
- MSDS
- Download (105 KB)
Clinical Trials
- Clinical Trials Learn More" title="About Clinical Trials" id="clinical-trials-info" class="drug-info-popup" href="javascript:void(0);">
Phase Status Purpose Conditions Count 3 Withdrawn Prevention Acute Kidney Injury (AKI) 1 2 Completed Diagnostic Heart Failure 1 2 Completed Treatment Acute Myocardial Infarction (AMI) 1 2 Completed Treatment Aging / Frailty / Sedentary Lifestyle 1 2 Completed Treatment Asthma 1
Pharmacoeconomics
- Manufacturers
- Not Available
- Packagers
- Not Available
- Dosage Forms
Form Route Strength Paste, dentifrice Dental Injection, solution; kit Intravenous Injection, solution Intravenous 30 mg/1mL Solution Intravenous 30 mg / mL - Prices
- Not Available
- Patents
Patent Number Pediatric Extension Approved Expires (estimated) Region US8496973 No 2013-07-30 2031-03-29 US US8568793 No 2013-10-29 2031-12-24 US US9585912 No 2017-03-07 2031-03-29 US US9345724 No 2016-05-24 2031-03-29 US US9687506 No 2017-06-27 2031-12-24 US US10479686 No 2019-11-19 2031-03-29 US US11753301 No 2010-02-10 2030-02-10 US
Properties
- State
- Solid
- Experimental Properties
Property Value Source melting point (°C) 271 MSDS boiling point (°C) 320 MSDS water solubility 820g/L MSDS logP -3.7 MSDS - Predicted Properties
Property Value Source logP 0.17 Chemaxon pKa (Strongest Basic) -3.5 Chemaxon Physiological Charge 0 Chemaxon Hydrogen Acceptor Count 3 Chemaxon Hydrogen Donor Count 1 Chemaxon Polar Surface Area 49.66 Å2 Chemaxon Rotatable Bond Count 0 Chemaxon Refractivity 8.72 m3·mol-1 Chemaxon Polarizability 2.81 Å3 Chemaxon Number of Rings 0 Chemaxon Bioavailability 1 Chemaxon Rule of Five Yes Chemaxon Ghose Filter No Chemaxon Veber's Rule No Chemaxon MDDR-like Rule No Chemaxon - Predicted ADMET Features
- Not Available
Spectra
- Mass Spec (NIST)
- Not Available
- Spectra
Spectrum Spectrum Type Splash Key Predicted MS/MS Spectrum - 10V, Positive (Annotated) Predicted LC-MS/MS splash10-0002-9000000000-f32ca30bef7a838cd1d9 Predicted MS/MS Spectrum - 10V, Negative (Annotated) Predicted LC-MS/MS splash10-0002-9000000000-a0441e6336543cb88423 Predicted MS/MS Spectrum - 20V, Negative (Annotated) Predicted LC-MS/MS splash10-0002-9000000000-a0441e6336543cb88423 Predicted MS/MS Spectrum - 20V, Positive (Annotated) Predicted LC-MS/MS splash10-0002-9000000000-c189e72adda743b6935b Predicted MS/MS Spectrum - 40V, Positive (Annotated) Predicted LC-MS/MS splash10-0002-9000000000-db13c8abb08153132277 Predicted MS/MS Spectrum - 40V, Negative (Annotated) Predicted LC-MS/MS splash10-0002-9000000000-a0441e6336543cb88423 Predicted 1H NMR Spectrum 1D NMR Not Applicable Predicted 13C NMR Spectrum 1D NMR Not Applicable - Chromatographic Properties
Collision Cross Sections (CCS)
Adduct CCS Value (Å2) Source type Source [M-H]- 110.721344 predictedDeepCCS 1.0 (2019) [M+H]+ 112.52464 predictedDeepCCS 1.0 (2019) [M+Na]+ 119.623634 predictedDeepCCS 1.0 (2019)
Targets
Build, predict & validate machine-learning models
Use our structured and evidence-based datasets to unlock newinsights and accelerate drug research.
Use our structured and evidence-based datasets to unlock new insights and accelerate drug research.
- Kind
- Protein
- Organism
- Humans
- Pharmacological action
- Yes
- Actions
- Oxidizer
- General Function
- Oxygen transporter activity
- Specific Function
- Involved in oxygen transport from the lung to the various peripheral tissues.
- Gene Name
- HBA1
- Uniprot ID
- P69905
- Uniprot Name
- Hemoglobin subunit alpha
- Molecular Weight
- 15257.405 Da
References
- Baskin SI, Horowitz AM, Nealley EW: The antidotal action of sodium nitrite and sodium thiosulfate against cyanide poisoning. J Clin Pharmacol. 1992 Apr;32(4):368-75. [Article]
- Kind
- Protein
- Organism
- Humans
- Pharmacological action
- Yes
- Actions
- Oxidizer
- General Function
- Oxygen transporter activity
- Specific Function
- Involved in oxygen transport from the lung to the various peripheral tissues.LVV-hemorphin-7 potentiates the activity of bradykinin, causing a decrease in blood pressure.Spinorphin: functions as an...
- Gene Name
- HBB
- Uniprot ID
- P68871
- Uniprot Name
- Hemoglobin subunit beta
- Molecular Weight
- 15998.34 Da
References
- Baskin SI, Horowitz AM, Nealley EW: The antidotal action of sodium nitrite and sodium thiosulfate against cyanide poisoning. J Clin Pharmacol. 1992 Apr;32(4):368-75. [Article]
- Kind
- Protein
- Organism
- Humans
- Pharmacological action
- Unknown
- Actions
- Oxidizer
- General Function
- Oxygen transporter activity
- Specific Function
- Serves as a reserve supply of oxygen and facilitates the movement of oxygen within muscles.
- Gene Name
- MB
- Uniprot ID
- P02144
- Uniprot Name
- Myoglobin
- Molecular Weight
- 17183.725 Da
References
- Baskin SI, Horowitz AM, Nealley EW: The antidotal action of sodium nitrite and sodium thiosulfate against cyanide poisoning. J Clin Pharmacol. 1992 Apr;32(4):368-75. [Article]
Drug created at September 21, 2015 16:24 / Updated at February 20, 2024 23:55